1 Aralık 2015 Salı

DNA Testi Nasil Yapilir ve Adlitip

DNA Testi Nasıl Yapılır ve Adlitıp

Her insanın DNA sı %99.8 aynıdır. Kişiye özgü olan kısım %0.2 lik kısımdır. Bu kısım test için yeterde artar. DNA testi dediğimiz zaman aklımıza ilk gelen babalık testidir.Ayrıca bu test adli tıptada kullanılır. İnsanda 2 çeşit kromozom vardır. Anneden gelen X ve babadan gelen Y kromozomu. Burada Y kromozomundaki DNA lar kullanılır. 

kromozom

Peki Bu DNA'lar nasıl kullanılır ? 

DNA nükleotitlerden oluşan dizilerden oluşmuıştur. Bu nükleotit dizileri bir araya gelerek genleri oluşturur. İnsan DNA sında kişiye özgü tekrarlayan gen bölgeleri vardır. Bu bölgeler belli oranlarda ve sırayla tekrar eder. DNA testinde bu tarz 15 ten fazla gen bölgesine bakılır. DNA örneği alındığı zaman ilk önce izole edilir. Forumda @ThutancamoN açtığı konuda evde DNA görüntülemiştik. Aslında bizde amatör olarak DNA yı izole ettik. DNA yı izole etmek demek üzerindeki proteinlerden arındırmaktır. DNA izole edildikten sonra çoğaltma işlemine geçilir. Bu yöntem ise PCR ( Polimeraz zincir reaksiyonlarıdır.) Bu yöntem ile 1 adet DNA yı bile 1 saat içinde milyarlarca kez kopyalayabilirsiniz. Makineye materyelleri koyar çalıştırır ve bilgisayardan kontrol edersiniz. Sonrasında DNA daha bunu gibi bir dizi işlemden daha geçer.

dna

Şimdi bir örnekle devam edelim. 

15 ten fazla gen bölgesine bakılır demiştik. İnsana ait DNA dizisiyle uğraşmak uğraştıracağı için hayali bir DNA dizisi yazıyorum. 
TTGCAGCTTAGCCCGATTCGATCCCG(A) Bu babanın gen bölgesi olsun. 
TTGCAGCTTAGCCCGATTCGATCCCG(G) Buda çocuğun gen bölgesi olsun. 
Örnekleri karşılaştırdığımızda 1 nükleotit hariç diğerlerinin tamamen aynı olduğunu görürüz. Bu gen dizilerinin aynı olması kişilerin yakın akraba olduklarını gösterir. Baba oğul ilişkisinde birkaç nükleotit hariç dizi tamamen aynıdır. Bu diziler aileye özgüdür. Peki niçin son nükleotitler farklı. Çünkü her DNA kişiye özgüdür. Bu tek bir gen dizisi. Eğer incelenen diğer gen dizileride böyle bir benzerlik taşıyorsa %98 üzeri bir ihtimalle bunlar baba oğuldur. 
Akrabalara bakıldığında ise bu kalıp gen bölgeleri kısmen korunumludur. Baba oğul ilişkisi kadar olmasada benzerler. 
Her ırka ait böyle gen bölgeleri vardır. Nat Geonun yaptığu DNA testindede bu ırka özgü gen bölgelerine bakarlar. 
Bu testin adli tıpta kullanılma mantığıda aynıdır. Bir ceset bulunduğunda kimlik tespiti yapılamıyorsa DNA alırlar. Akrabası olduğu iddaa edilen kişilerden kan ve tükürük örneği alarak bu testi yaparlar. 
Bir programım var. Her türlü canlının DNA ları karşılaştırıp benzerlikleri ve farklılıkları gösteriyor. 

Ek olarak görüntülenen ilk DNA molekülü.

dna molekülü




1 yorum:

  1. Ailevi tüm dna testi için hizmetinizdeyiz..

    “Acaba çocuğumun gerçek babası mıyım?” sorusu, son yıllarda binlerce kişinin hastane ve laboratuvarların kapısını aşındırmasına neden oldu.

    Türkiye genelinde resmi rakalamlar ile günde 100 resmi olmayan rakamlar göre 250 kişi babalık testi için özel hastahanelere başvuruyor ve fiyatlar 1500 TL ‘den 5000 TL ‘ye kadar değişkenlik gösterebiliyor.

    21 Yıldır yerli sermaye ile hizmetinizdeyiz annelik , babalık ve kardeşlik testleri için yüksek teknoloji laboratuvarımız dan yararlanrak hizmetinize sunuyoruz! Tüm testlerimiz %99 doğruluk derecesine sahiptir %1 kısım iste genel olarak oluşabilecek aksaklıklar göz önüne alınarak hesaplanmıştır.

    Babalık Testi

    Oldukça kolay bir şekilde yapılabilen ve kısa süre içerisin de sonuçlarını alabileceğiniz babalık testi için sizlere hizmet vermekteyiz.

    Annelik Testi

    Genelde evlatlık olduklarını düşünen aile bireyleri tarafından yapılan test biçimi annelik testidir bu test için de sizlere hizmet verebilmekteyiz.


    Kardeşlik Testi

    Genelde miraz davaları ve buna benzer davaların açılmasın dan önce şüpheleri gidermek için yapılan kardeşilik testi konusunda da uzman kadromuz ile hizmetinizdeyiz.



    YanıtlaSil